Caborian. Comunidad de fotografía.

Archive for mayo, 2008

Un día en las Carreras ( Jerez 2008 )

viernes, mayo 30th, 2008

Por Jose Manuel Colomo ( Russell Price ).

Hola a todos.

Con motivo del último G.P. de motociclismo en Jerez, el equipo de redacción de esta nuestra comunidad me dijo que si quería contar más batallitas, pues que adelante, y les dije que me lo pensaría. Y lo he hecho. Pensarlo, digo.

Hace ya un par de años, Gabi (Bosco) ya hizo un pequeño resumen de lo que supone estar un par de días currando en un Gran Premio, así que no quería repetirme ni aburrir a la audiencia.

Como Caborian se encuentra inmerso en un giro hacia La Fotografía, yo también pensé que habría que enfocar esto desde un punto de vista (nunca mejor dicho, ya veréis por qué) puramente fotográfico. Así pues, voy a intentar plasmar aquí lo que un fotógrafo del montón de los que se encuentran en el Circuito de Jerez durante un largo fin de semana, piensa, planifica y finalmente hace (o intenta hacer) para cubrir las solicitudes que supone su trabajo.

Cuando aterricé por primera vez en un circuito durante un Gran Premio, mi inexperta mirada fotográfica no concebía más allá de “una curva-una foto”. Bueno, como mucho, “una curva-foto y media”. Y eso que llevaba la tira de años gastándome el dinero en el Motociclismo en vez de en “las moscas” de las máquinas de videojuegos…
Mi capacidad para “ver” un posible encuadre original no ha mejorado mucho, pero aunque sólo sea a fuerza de repetir y de patearme los viales de servicio de Jerez y Montmeló durante una docena de GG.PP., la necesidad de hacer algo diferente y mínimamente original, de volver con un poco de variedad, me ha enseñado que hay casi tantas fotos como pasos puedes dar por los viales de los circuitos…una vez que te bajas de la furgoneta de “Photo Shuttle”.

Lo que sigue vale lo mismo para quien en el futuro pueda tener la ocasión de fotografiar desde alguno de los dos lados del muro de los 4 kilómetros y pico del circuito de Jerez, como para quien lo haga desde cualquier otro circuito del mundo, porque no se trata tanto de marcar localizaciones y encuadres, como de abrir la mente y los ojos del fotógrafo cuando parece que “aquí no hay foto”.

No cuesta apenas trabajo echarse la cámara al ojo y mirar por ella para imaginar cómo quedará la foto en un punto determinado. Aunque las motos no estén rodando aún, podemos adelantar el trabajo de análisis para no perder tiempo luego, cuando tenemos el tiempo limitado para hacer las fotos.

Haz el movimiento de barrido, mira cómo queda, mira los fondos, fundamentales para redondear una buena foto de acción, mira a tu alrededor, fíjate en la postura tan diferente de un piloto sobre la moto en apenas unos metros. Una rueda delantera ligeramente en el aire en una aceleración, o tocando el suelo, marca la diferencia entre una foto espectacular y una foto simplemente buena. Aléjate o acércate lo necesario para que la foto que vayas a hacer sea la que querías hacer. Aunque parezca de perogrullo, un tele de focal fija tiene el rango de focales más antiguo del mundo : tus pies.

Yo trabajo para una agencia que está enfocada principalmente a la fotografía de archivo, más que a la foto de la noticia para los diarios del día siguiente. Es por eso que necesito volver a casa con un buen conjunto de imágenes de cada piloto.
Las fotos que he hecho en pista este año de Dani Pedrosa, van a servirnos para ilustrar la realización de ese objetivo. Con excepciones, vienen a ser las fotos que también he hecho de los principales pilotos, quizá más completo por ser uno de los que más demanda de imágenes genera.

Vamos a dar una vuelta al circuito viendo desde dónde, por qué y cómo están tomadas las fotos.


Caborians en el Desafío de Canon

jueves, mayo 29th, 2008

Ahora que el primer corte dentro del concurso de Canon, el Desafío ha finalizado. Podréis apreciar que hay unos cuantos Caborians en la siguiente fase. Entre los que hemos podido reconocer (si hay alguna omisión)


Carles Costa Parareda / elCarles – Tenís de Mesa

Francisco Javier Drieguez García – Un Paseo por las Nubes

Ramón Tur Marí / ramontur – GUAGUAGUGAGUAUGUUUUUU


Deo Villasante / Deo – San Juan de Gaztelugatze


Siro Moya / elDruida – Pompita

Los finalistas, según reza la página de Canon, serán elegidos por un jurado experto, dirigido por Vicki Couchman.

Desde Caborian queremos apoyar a todos los Caborians que han pasado a la siguiente fase. No nos cabe duda, de que más de uno conseguirá llevarse el gato al agua!

¡Mucha suerte a todos!

Publicado por Alex Conceiro – THuRStoN

Robert Frank: «Los americanos», en castellano tras 50 años

martes, mayo 27th, 2008

Hay libros que son hitos de la historia de la fotografía. Uno de ellos es, sin duda, «The Americans», de Robert Frank. Con motivo del cincuenta aniversario de su publicación, La Fábrica Editorial lo reedita con la peculiaridad de ser la primera vez que se hace en castellano.

Este libro cambió el fotoperiodismo, de tal modo que hay un antes y un después de él. Cuando vio la luz, la idea de «el momento decisivo» de Cartier-Bresson era la norma imperante. Pero Frank se revela huyendo de esos momentos y buscando los instantes intersticiales, aquellos en que «no pasa nada» por considerarlos más llenos de verdad y para abrir el mundo de los reportajes a la visión subjetiva y creadora del fotógrafo, que pasa a ser el verdadero «protagonista», relegando al objeto de su foto a un segundo plano.
Es el fotógrafo el que se impone al medio y busca sus fotos y su discurso, en vez de ser un cazador que espera a que ocurra algo. Con ello, las imágenes pasaron de ser un lenguaje universal que incluso los niños podían entender a conformar un discurso complejo que requiere cierto esfuerzo por parte del observador, abriendo la puerta a las interpretaciones, o directamente a no ser capaz de entender lo que el fotógrafo nos quiere contar.

La otra gran aportación de Frank con este libro fue pasar de entender los reportajes como un grupo de fotos sueltas, con entidad individual, a fotos que han de ser entendidas como conjunto, con un orden específico, donde el aspecto emocional pasa a primer plano, y la experiencia es más literaria, por decirlo de algún modo.

Un cambio radical que en principio fue rechazado y duramente criticado. Tanto por su lenguaje como por su punto de vista.
Eran los años 50, los de la guerra fría y el ideal del sueño americano. Sin embargo la visión que ofrece Frank de los Estados Unidos es otra, pero no por ello menos real (quizá incluso más). La de las carreteras, los locales vacíos, las junkbox, los televisores, las periferias, la soledad, los políticos… y la bandera, que en muchas ocasiones tapan a las personas que salen en las imágenes.

¿Cómo se podía intentar publicar la foto de una persona a la que no se le ve la cara porque está tapada por una escalera? Si a esto unimos composiciones desequilibradas y ambíguas, imágenes movidas por estar tomadas en lugar con luz escasa o simplemente desenfocadas, obtenemos un conjunto que para muchos resultaba ininteligible. Y para colmo, ni rastro del «paraiso» americano. Por ello cuando llevó las primeras fotos a la revista Life, con la que ya publicara anteriormente, las rechazaron diciéndole que el país retratado «se parecía demasiado a Rusia«.
Los críticos aseguraban que aquello era deprimente y que no era «su América«.

Sin embargo, hubo gente que supo apreciar y entender lo que Robert Frank había logrado. Uno de los primeros fue Walker Evans, que alavó la ironía literaria y lo revelador de esa serie, que muestra lo que habitualmente no vemos, no queremos ver o simplemente los estereotipos no nos dejan ver.
Otro, Jack Kerouac, que realizó el prólogo del libro pues le parecía un magnífico poema. La generación beat sintonizó perfectamente con esas ideas de Frank del viaje, la carretera y la búsqueda personal.

Pero pese a esos apoyos, Frank no encontró ninguna revista en Estados Unidos que quisiese publicar semejante material, así que finalmente salió en formato de libro, en 1958, tras encontrar un editor en Francia.

Un año después se publico en Estados Unidos, y poco a poco, las vías anticipadas por Robert Frank cuajaron y el mundo de la fotografía se adueño de esas ideas. Abrió el camino para Diane Arbus, el imaginario de América se amplió con sus nuevos escenarios de carretera y soledades, influyó en cineastas como Wim Wenders y en innumerables fotógrafos como Mary Ellen Mark que dijo: «El libro es una inspiración para mi. Frank es un purista, es honesto y no manipula lo que ve. Es capaz de fotografiar lo que sea. Es un fotógrafo narrativo, y puedes ver lo que pasa fuera de la foto«.

En fin, que ya tenemos en castellano un libro que supuso una bocanada de libertad para el mundo de la fotografía de reportajes.

Publicado por Héctor Fdez.

Nuevo respaldo Hasselblad CFV-II

lunes, mayo 26th, 2008

Hasselblad actualiza su respaldo CFV (en la foto) con el nuevo CFV-II.

Sigue siendo un dispositivo de 16 megapíxeles, en formato cuadrado, para cámaras de tipo V.
Las mejoras consisten en una pantalla de mayores dimensiones, con mejor visibilidad, nuevo diseños de botones para hacerlos más cómodos, y sobre todo un nuevo filtro IR que mejora la calidad de la imagen especialmente en situaciones de contraluces al reducir posibles reflejos.

Pequeñas mejoras que por lo menos indican que Hasselblad sigue mirando (al menos mínimamente) por sus clientes con cámaras de tipo V.

El precio de dicho respaldo ronda los 6.400€

Publicado por Héctor Fdez.

What the Duck número 472

sábado, mayo 24th, 2008


por wiggin

Muere Cornell Capa

sábado, mayo 24th, 2008

Ayer, viernes 23 de mayo de 2008, murió en Nueva York el fotógrafo Cornell Capa. Tenía 90 años.

Más información:
pdn onlin
El País

Taller de Ricky Davila en «Mieres 2008»

jueves, mayo 22nd, 2008

PUNTO DE VISTA: Taller de Ricky Davila en «Mieres 2008» orientado a fotógrafos jóvenes y profesionales en busca de un proyecto personal y de un posicionamiento propio en el ámbito de la fotografía, se celebrará del 29 al 31 de mayo con motivo de las II Jornadas Internacionales de Fotoperiodismo Mieres 2008 en la Casa de Cultura de Mieres (Calle Manuel LLaneza, 8) de 10h a 13.30h y de 16h a 19.30h.

Su precio es de 90€ para socios de APFA, 90€ para estudiantes de Imagen y fotografía y 180€ para no socios. El plazo de inscripción finaliza el 26 de mayo.

Teneis mas información en

Para ver el programa de las Jornadas picar sobre la imagen de abajo.

Por tejeqteje