Caborians en el Desafío de Canon

Editado el 29/05/2008 por THuRStoN

Ahora que el primer corte dentro del concurso de Canon, el Desafío ha finalizado. Podréis apreciar que hay unos cuantos Caborians en la siguiente fase. Entre los que hemos podido reconocer (si hay alguna omisión)

Deportes

Carles Costa Parareda / elCarles – Tenís de Mesa

http://ta.canon-europe.com/?pg=gallery&cc=es&lc=es&photo_id=foto4800d8ce52e79

Francisco Javier Drieguez García – Un Paseo por las Nubes

http://ta.canon-europe.com/?pg=gallery&cc=es&lc=es&photo_id=foto48175d9243c9e

Ramón Tur Marí / ramontur – GUAGUAGUGAGUAUGUUUUUU

http://ta.canon-europe.com/?pg=gallery&cc=es&lc=es&photo_id=foto48189231a5bba

Paisajes

Deo Villasante / Deo – San Juan de Gaztelugatze

http://ta.canon-europe.com/?pg=gallery&cc=es&lc=es&photo_id=foto47f38181c13d9

Macro

Siro Moya / elDruida – Pompita

http://ta.canon-europe.com/?pg=gallery&cc=es&lc=es&photo_id=foto47fd10642166

Los finalistas, según reza la página de Canon, serán elegidos por un jurado experto, dirigido por Vicki Couchman.

Desde Caborian queremos apoyar a todos los Caborians que han pasado a la siguiente fase. No nos cabe duda, de que más de uno conseguirá llevarse el gato al agua!

¡Mucha suerte a todos!

Publicado por Alex Conceiro – THuRStoN

Comments are closed.